Tuesday, February 23, 2010

DEBATE

Argument

PRO: DNA record keeping is an invasion of privacy

Points:

>Disrimaination to many
~Eugenics
~Hitler
>Penalties
~Laws are not clear
-inappropriate release of information to employers
-employment discrimination
-higher medical cost
>Human Choice
>Taking DNA records at birth
~violates medical ethics
~new mothers in bad positions

DEBATE:

Invasion of privacy is an issue that we face from day to day but have you ever thought about it being more than skin deep? You may be concerned about this but have you ever considered the privacy of your DNA? Think about it in this way--your DNA is your own unique makeup and therefore it is you, so when people judge your genes they are judging you!------------
DNA record keeping has played a key role in the discrimination of people in the United States since the early 1900's. Eugenics is a philosophy that encourages the manipulation of human traits through the use of social or technical intervention. This led to the involuntary sterilization of "genetically unfit" people. The mentally ill, autistic, specific races, etc are just a few prevented from passing on their genes. This outrageous discrimination would not have come about if their DNA privacy was never invaded.--If this has not convinced you enough, just know that Hitler used the same philosophy as a rationale to exterminate the Jewish Race. Although the government has taken certain actions to prevent genetic discrimination many people still choose not to undergo genetic testing because the laws are not clear regarding the privacy of individual's genetic records. Information is often inappropriately released to employers resulting in employee discrimantion and higher medical cost.--People do not choose their genteic makeup and therefore should not be penalized for it. To do so is the ultimate invasion of genetic privacy! An individuals genetic information is a private matter and it should be the choice of the individual to give it out or not. A person should have the right to control their own personal DNA. A recent study at Harvard and Stanford Universities revealed that over 200 cases of discrimination has occurred because of genes that individuals carried or were suspected of carrying. This invasion of privacy is a devasting feeling and experience that one should not have to endure. Many people feel that DNA record keeping is an invasion of privacy. To elaborate, the Open Rights Group emphatically opposes the collection of the populations DNA at birth, and can see no circumstance under which this should be considered. Such an action violates medical ethics, puts new mothers in an ethically unacceptable position, and is a gross invasion of privacy.---
But I leave you with the question- How would you feel if you were negatively affected becuase of someone elses invasion of your privacy?

Bibliography
http://cpab.info/Documents/Gina_bam_5-22-08.htm
http://wiki.openrightsgroup.org/wiki/DNA_Consultation
Prentice Hall pg 354



Partner: Lizzie Paluso

Argument

CON: DNA record keeping is an invasion of privacy

>Remains of soldiers could not be found if their DNA wasn't previously stored
>Investigators could not determine suspects of a crime, some of which may be a potential threat to citizens
>Althought some says it allows the government to access private health records, whats the harm? >The government can use it as a helpful protective tool and it really has no true harm to anyone. >One should have confidence in their behavior that it shouldn't matter if a record of their DNA is kept.
>Having someone volunteer to have their DNA tested by different research companies can help us determine ways to fight off diseases we may have never been able to before.

Reflection:

I have not yet debated but I look froward to it. I think that I should do fine because I have prepared myself and am confident in my research and the knowledge of my topic. I am a little afraid though because i do not like to speak in front of people and I often get afraid when doing so. I tend to speak faster and get tripped up over my words so I hope that that will not happen. I am also concerned about the debate because I know that Lizzie will have some strong points and I have to be confident enough in my stand point to spark emotions in the listeners. I really look forward to he debate though and I just need to shake my fears of speaking in front of people!

DESIGN A CREATURE

Single Allele Traits: Body Shape/ Wing Shape

BB- square body
Bb- square body
bb- oval body

WW- round tip wing shape
Ww- round tip wing shape
ww- round and pointed tip wing shape

Codominant Trait: Wing Design

DD- solid color wings
Dd- pokey dot wings
dd- solid with pokey dot wing shape

Multiple Allele Trait: Antennas

AA- straight dot antenna
CC- crinkly open circle antenna
SS- straight smiley face antenna
SC- straight open circle smiley face antenna

Sex Linked Trait: With or Without Feet

XFXF- female no feet
XFXf- female no feet
XfXf- female with feet

XFY- male no feet
XfY- male with feet

Incomplete Dominance Trait: Eye Color

EE- brown eye color
Ee- green eye color
ee- hazel eye color




Displayed Traits of Sally My Butterfly

Single Allele Traits

bb & ww- oval body shape and rounded & pointed wing shape

Codominant Trait

dd- solids with pokey dot wing design

Multiple Allele Trait

SC- straight open circle smiley antennas

Sex Linked Trait

XFXF- female with no feet

Incomplete Trait

EE- brown eye color
Pedigree: Body Shape

Punett Square cross between Recessive body type and Recessive wing shape
Practice Problems:

1. If a homozygouse brown eyed creature is crossed with a heterozygous green eyed creature what color eyes would the F1 generation have?

2. The codominant trait of solid color(s) wings with pokey dots was the F1 generation of a homozygous male with solid wing design and a female. What are the possible gentoypes of the female?

3. A heterozygous recessive female with feet mated with a male with no feet. What is the possibility that their daughter off spring will have feet?

SALLY'S DNA FINGERPRINTING

CATGCCCCTGGGCTAAAACCGCTACGATGCTGATATTTTAGTTTGGAAGTGGATGCTCTGCTACC
GTACGGGGACCCGATTTTGGCGATGCTACGACTATAAAATCAAACCTTCACCTACGAGACGATGG